Biotechnological tools
Your browser does not support viewing this document. Click here to download the document.
|
Recombinant DNA
Recombinant DNA is a new DNA molecule made from two different sources. In recombinant DNA technology, molecular biologists use tools and processes that enable them to analyze and alter genes and their respective proteins. This research has led to exciting new advances in biotechnology. This activity for teachers to use in classroom with the students to get them engaged in hands-on learning process. The activity is how to make a recombinant DNA using Play dough. This is a fun work group activity for the students to use their imagination, encourage their creativity, and more possibilities for conversation and interaction between each other |
Restriction enzymes
restriction enzymes, are molecular scissors that can cut double-stranded DNA at a specific base-pair sequence. Each type of restriction enzyme recognizes a characteristic sequence of nucleotides that is known as its recognition site. Molecular biologists can use these enzymes to cut DNA in a predictable and precise manner. Recognition Site recognition site is a specific sequence within double- stranded DNA, usually palindromic and consisting of four to eight nucleotides, that a restriction endonuclease recognizes and cleaves |
![Picture](/uploads/6/0/8/4/60840857/7661443_orig.gif)
sticky ends
Sticky ends are fragment end of a DNA molecule with short single stranded overhangs, resulting from cleavage by a restriction enzyme
Activity # 2 DNA palindrome ATGAATTCAGGCTAGGATATCCCAAGCTCGAGAATATCCAAGA TCTTGGCCACC (a) Write out the sequence of the complementary strand. (b) Identify the palindromic sequence in the molecule Remember: Adenine (A) pairs up with Thyamine (T) Cytosine (C) pairs up with Guanine (G) |
This activity is very important for teachers to teach the students about the Palindromic sequences. And to clarify the misconception, that DNA palindrome on double stranded DNA reads the forward direction on one strand and the backward direction on the other strand, and not the forward and the backward directions on the same strand |
![Picture](/uploads/6/0/8/4/60840857/8564082.gif?1457890326)
Methylases
Methylases are specific enzymes found in prokaryotes and eukaryotes. In prokaryotes, they modify the recognition site of a respective restriction endonuclease by placing a methyl group on one of the bases, preventing the restriction endonuclease from cutting the DNA into fragments. EcoRI methylase,
for example, adds a methyl group to the second adenine nucleotide in the EcoRI recognition site, preventing EcoRI from cutting the DNA.When foreign DNA is introduced into the bacterium, it is not methylated, rendering it defenceless against the bacterium’s restriction enzymes.
Methylases are important tools for a molecular biologist when working with prokaryotic organisms. They allow the molecular biologist to protect a gene fragment from being cleaved in an undesired location.
Methylases are specific enzymes found in prokaryotes and eukaryotes. In prokaryotes, they modify the recognition site of a respective restriction endonuclease by placing a methyl group on one of the bases, preventing the restriction endonuclease from cutting the DNA into fragments. EcoRI methylase,
for example, adds a methyl group to the second adenine nucleotide in the EcoRI recognition site, preventing EcoRI from cutting the DNA.When foreign DNA is introduced into the bacterium, it is not methylated, rendering it defenceless against the bacterium’s restriction enzymes.
Methylases are important tools for a molecular biologist when working with prokaryotic organisms. They allow the molecular biologist to protect a gene fragment from being cleaved in an undesired location.
![Picture](/uploads/6/0/8/4/60840857/1510118_orig.jpg)
DNA Ligase
DNA ligase is the enzyme used for joining the cut strands of DNA together.
Using a condensation reaction, DNA ligase drives out a molecule of water and reforms
the phosphodiester bond of the backbone of the DNA. Joining strands with blunt ends
using DNA ligase is very inefficient.Molecular biologists use T4 DNA ligase, an enzyme
that originated from the T4 bacteriophage, to join blunt ends together
DNA ligase is the enzyme used for joining the cut strands of DNA together.
Using a condensation reaction, DNA ligase drives out a molecule of water and reforms
the phosphodiester bond of the backbone of the DNA. Joining strands with blunt ends
using DNA ligase is very inefficient.Molecular biologists use T4 DNA ligase, an enzyme
that originated from the T4 bacteriophage, to join blunt ends together
Plasmids
Plasmids are small, circular, double-stranded DNA molecules lacking a protein coat that naturally exist in the cytoplasm of many strains of bacteria, and can exit and enter bacterial cells. Plasmids are independent of the chromosome of the bacterial cell and range in size from 1000 to 20000 base pairs. |